• Don't want to see ads? Install an adblocker like uBlock Origin or use a Europe-based privacy-friendly browser like Vivaldi or Mullvad.

Introduction new member (Y-DNA: J-L283)

The most knowledgeable person on J2b-L283 is Trojet. He is an admin of the J2b project at FTDNA.

From my understanding, without a Y37 or bigY test we can’t know for certain where you paternal ancestor is derived. However,J2b-L283 was found in the remains of a Proto-Illyrian in Dalmatia. It is one of the most common lineages in Albanians, especially Albanian highlanders(Ghegs).

Considering the migration of Albanians to Romania and especially Bucharest, I would say your paternal ancestor was likely one of many Orthodox Christians Albanians that migrated there.

The best way to be certain is to take that test. This way, if you have Albanian matches in recent history it would be a guarantee. If your matches with Albanians go back to classical history, then it could have been a Illyrian or Daco-Thracian that splintered off.


Albanian orthodox who migrated to romania? Interesting story, where did you get this? I would loke to read more about this.

My paternal grandma is Aromanian (Çoban), she told me that according to the chrnoicles of my ancestors from her side they were shepherds from Tetovo and Rugovo that came 200 years ago from makedonia to albania, in particular Divjake/Lushnje area + in korça, elbasan and tirana where it's full of them.
Surname of her family Gorrea, is this any vlach/romanian surname or what? + another side pf her family has surname Rrudha/Rrudho.
 
Albanian orthodox who migrated to romania? Interesting story, where did you get this? I would loke to read more about this.

My paternal grandma is Aromanian (Çoban), she told me that according to the chrnoicles of my ancestors from her side they were shepherds from Tetovo and Rugovo that came 200 years ago from makedonia to albania, in particular Divjake/Lushnje area + in korça, elbasan and tirana where it's full of them.
Surname of her family Gorrea, is this any vlach/romanian surname or what? + another side pf her family has surname Rrudha/Rrudho.

Its pretty well known from what I can tell.

https://en.m.wikipedia.org/wiki/Albanians_of_Romania
 
Albanian orthodox who migrated to romania? Interesting story, where did you get this? I would loke to read more about this.

My paternal grandma is Aromanian (Çoban), she told me that according to the chrnoicles of my ancestors from her side they were shepherds from Tetovo and Rugovo that came 200 years ago from makedonia to albania, in particular Divjake/Lushnje area + in korça, elbasan and tirana where it's full of them.
Surname of her family Gorrea, is this any vlach/romanian surname or what? + another side pf her family has surname Rrudha/Rrudho.

Gorea (single r) is not a popular surname, but it still exists. I know one person with this surname.

http://nume.ottomotor.ro/en?search=Gorea&type=circle

Same goes for Ruda.
http://nume.ottomotor.ro/en?search=Ruda&type=circle

Both are most popular in mountainous regions, so maybe they are the descendants of a settled shepherd (cioban in Romanian).
 
I am in the process of being tested for YSEQ J2b-M12 and I've received a part of my results today. However I really need help interpreting what it all means. My allele results are as follows:


M241 A+
PH1568 C+
Z638 G-
Z2432 G-
CTS3617 processing
Z590 processing


I think the minus sign means that I am negative for the mutation being tested, and the plus sign means that the mutation is present.


The rest of alleles are negative.


So I am M241 A+ and PH1568 C+. Is this subclade PH1568 C+ known to be specific to some region or people? Or how should I interpret it? Does anyone else shares similar results?
 
Строительство из сэндвич панелей — это одна из современных методик, по которой сейчас строится множество промышленных сооружений — склады, ангары, сельскохозяйственные постройки (теплицы, зерно- и овощехранилища, фермы).
 
I am in the process of being tested for YSEQ J2b-M12 and I've received a part of my results today. However I really need help interpreting what it all means. My allele results are as follows:
M241 A+
PH1568 C+
Z638 G-
Z2432 G-
CTS3617 processing
Z590 processing
I think the minus sign means that I am negative for the mutation being tested, and the plus sign means that the mutation is present.
The rest of alleles are negative.

So I am M241 A+ and PH1568 C+. Is this subclade PH1568 C+ known to be specific to some region or people? Or how should I interpret it? Does anyone else shares similar results?

Nice, it seems YSEQ nailed your "terminal" subclade rather quickly. PH1568 is equivalent to YFull's J-Y40288. So your phylogentic position is: J-L283>...>Y15058>Z38240>PH1602>PH1568,Y40288: https://www.yfull.com/tree/J-Y15058/

As you can see, including PH1568 there is a total of 16 SNPs at YFull's J-Y40288 level, currently shared by a Serbian and a Bulgarian. So I would watch that subclade and see how it develops with more NGS tests, as it's technically possible you might be negative for some of them.

Including the FTDNA database, in this subclade there is members from Bosnia, Serbia, Bulgaria, NW Greece (Vlach), and now Romania. I think it indicates this particular subclade may have spread out with Vlachs (Romanized natives). The ancient roots, however, are most likely in the Western Balkans, since it's the same J-L283 branch as I4331, the proto-Dalmatian.
 
As you can see, including PH1568 there is a total of 16 SNPs at YFull's J-Y40288 level, currently shared by a Serbian and a Bulgarian. So I would watch that subclade and see how it develops with more NGS tests, as it's technically possible you might be negative for some of them.

There is actually a division within J-Y40288 as suggested by scientific samples from the Phille Hallast study. As can be seen below, PH1568 is one of the upstream SNPs, so YSEQ should test you for PH3514 next.

4zpZbzI.jpg
 
Thanks a lot Trojet for your explanations.


From my understanding CTS3617 (which is currently still processing) comes before PH1568 (J-Y40288) so it should be also positive.


In this case the only subclade below PH1568 seems PH3514. Is this the only one I should be testing at this point or also other(s)?


As for Z590 (also in processing), this comes before Z638 where I am negative, so it's not relevant anymore for me to keep digging there too.
 
Hi all,


I just wanted to introduce myself since I am a new member of this forum.


I am Romanian, born in Bucharest and I find it fascinating to learn more about my ancestry.


As far as I know all my close relatives (up until grand-grand parents) were born in what was once called Wallachia - most of them in Moroeni - Targoviste - Ploiesti - Bucharest area. Via 23andme I have learned that my Y-DNA halplogroup is J2 (M172) > J2b (M102) > J2b2 (Z1825) > J-M241 > J-L283 and my mtDNA is J1. I just don't know how to interpret all these results. I would be very grateful if you could help a bit out here. I will be very happy to share my ancestry details on specific websites dedicated to DNA studies and to deepen my DNA search - I mean going to search further via subclades. However I don't know quite how and where to start. All ideas or suggestions are welcome.

Thank you in advance!

Moroieni were people that most likely were from SE Celtic tribes.
The local Dacians and Gothic/East Germanic tribes were calling them "Moroi", because their culture related to the night,moon and so on.
So, your J-L283 can have moved very well from Balkans to North of Danube, in Romania, with some SE Celtic ethnics, an assimilated Balkanic person, that become Celtized and later migrated in Dacia.
Mixed with local women and his descendants become Dacians/Romanians.
:)
 
Thanks a lot Trojet for your explanations.
From my understanding CTS3617 (which is currently still processing) comes before PH1568 (J-Y40288) so it should be also positive.
In this case the only subclade below PH1568 seems PH3514. Is this the only one I should be testing at this point or also other(s)?
As for Z590 (also in processing), this comes before Z638 where I am negative, so it's not relevant anymore for me to keep digging there too.

Yes, CTS3617 is at the same level as Y15058, so you will be positive. Z590 is at the same level as L283, so that one will be positive as well. You can find all this info in the YFull tree. All equivalent SNPs are listed next to the corresponding clade. For example at J-Y15058 there is a total of 5 SNPs (Y15058/Z34462 * CTS3617 * CTS9215* +2 SNPs)
https://www.yfull.com/tree/J-L283/

And yes, currently PH3514 is the deepest/youngest remaining SNP that would be worth testing for you, as it falls below J-PH1602>PH1568 where you are positive. I'm not sure if YSEQ will automatically include PH3514 as part of the J2b-M12 Panel. In case they don't, I would definitely inquire about it..
 
Last edited:
Moroieni were people that most likely were from SE Celtic tribes.
The local Dacians and Gothic/East Germanic tribes were calling them "Moroi", because their culture related to the night,moon and so on.
So, your J-L283 can have moved very well from Balkans to North of Danube, in Romania, with some SE Celtic ethnics, an assimilated Balkanic person, that become Celtized and later migrated in Dacia.
Mixed with local women and his descendants become Dacians/Romanians.
:)

Interesting scenario. I'm not sure about that, maybe you go a bit too far in the past.

Here's what I've personally found about that word:

"The patronym Moroianu derives from a nickname by which the inhabitants of the hill areas of Muntenia called the Romanian migrant shepherds from Bran. During the descent of the sheep, in late autumn, to their wintering places (in Romanian = “iernat”) in Balta Dunării, Dobrogea/Dobrudja and Bugeac/Budjak, they looked like frightening spirits to the locals (in Romanian = moroi), appearing into the light and heavy rain in the misty weather (in Romanian = “ploaie mocănească”). Derived from this nickname, the place-name Moroieni appears in the Subcarpathians, in Dâmbovița County, and the settlement was probably founded by the mentioned shepherds."

Anyway if you have some sources regarding the etymology of this word from another perspective, I would be glad to see them :)
 
Trojet said:
<...> I'm not sure if YSEQ will automatically include PH3414 as part of the J2b-M12 Panel. In case they don't, I would definitely inquire about it..

Here's what I found on their website:

PH3514

hg38 Position: ChrY:15809390..15809390
Ancestral: G
Derived: A
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream PH1601
Forward Primer: PH3514_F AAGAAACCCTGGTTGGAAGC
Reverse Primer: PH3514_R CAGCCTGGAAACTAGCCAAC
 
Here's what I found on their website:
PH3514

hg38 Position: ChrY:15809390..15809390
Ancestral: G
Derived: A
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream PH1601
Forward Primer: PH3514_F AAGAAACCCTGGTTGGAAGC
Reverse Primer: PH3514_R CAGCCTGGAAACTAGCCAAC

Yes, they have it available in their catalog. But sometimes not every known SNP/subclade is included in a Panel. By inquiring, I meant in case they don't automatically test you for it, I would ask them if they will test it as part of the J2b-M12 Panel that you ordered, so you don't have to order it separately for an additional $18. I would also send them this tree from the J2 Project where it shows it downstream J-PH1602>PH1568: http://tree.j2-m172.info/?Hg=J2b2a1a1b1b1
 
Interesting scenario. I'm not sure about that, maybe you go a bit too far in the past.

There is one realistic scenario especially if you happen to be a basal J-Y40288. In the time of Principate Delmatae were settled to work in mines first in Eastern Dalmatia and then some were settled to Dacia. Namely mines near forts Baridustarum and Starva near Alburnus Maior/Roşia Montană.

For ex. Dasas Liccai, a Delmatae in castellum Starva from 2nd century
Panenti Bizonis, Delmatae in castellum Starva, 2nd century

From studies PH1602 seems rare in Romania, with Z631 dominating. I know of 6 J-L283, likely Z631- from Romania, 2 are missing dys456, 3 have dys456=13 so likely PH1602-, one from Mehenditi has dys456=0, and this might be a similar situation with Bulgarian study where 5 are also missing dys456, most likely they all have 12 as this clade is already present there in at least two from FTDNA.

I see from same (Basarab) study five Romanian I-L38's, 2 have dys456=13 so also a low value while three have dys456=0 again. Considering that most likely mutations from 13 are 14 and 12, and there are many with dys456=14 in the study, but no dys456=12, only dys456=0 I think indeed this is an indication that RU389 from Mehedinți has dys456=12 and is likely PH1602.


[TD="align: left"] RU389 [/TD]
[TD="align: left"] Meh [/TD]
[TD="align: right"] 12 [/TD]
[TD="align: right"] 24 [/TD]
[TD="align: right"] 15 [/TD]
[TD="align: right"] 10 [/TD]
[TD="align: right"] 14 [/TD]
[TD="align: right"] 17 [/TD]
[TD="align: right"] 11 [/TD]
[TD="align: right"] 15 [/TD]
[TD="align: right"] 11 [/TD]
[TD="align: right"] 12 [/TD]
[TD="align: right"] 11 [/TD]
[TD="align: right"] 29 [/TD]
[TD="align: right"] 15 [/TD]
[TD="align: right"] 16 [/TD]
[TD="align: right"] 19 [/TD]
[TD="align: right"] 10 [/TD]
[TD="align: right"] 0 [/TD]
[TD="align: right"] 9 [/TD]
[TD="align: right"] 21 [/TD]
 
Interesting scenario. I'm not sure about that, maybe you go a bit too far in the past.

Here's what I've personally found about that word:

"The patronym Moroianu derives from a nickname by which the inhabitants of the hill areas of Muntenia called the Romanian migrant shepherds from Bran. During the descent of the sheep, in late autumn, to their wintering places (in Romanian = “iernat”) in Balta Dunării, Dobrogea/Dobrudja and Bugeac/Budjak, they looked like frightening spirits to the locals (in Romanian = moroi), appearing into the light and heavy rain in the misty weather (in Romanian = “ploaie mocănească”). Derived from this nickname, the place-name Moroieni appears in the Subcarpathians, in Dâmbovița County, and the settlement was probably founded by the mentioned shepherds."

Anyway if you have some sources regarding the etymology of this word from another perspective, I would be glad to see them :)
Oh.
Very interesting.
So in Moroieni are people that came from Bran.
Both Celts and Dacians were mostly pastolarist people.
Another thing, Bran is one of the few name places in Romania,that is almost surely of Celtic origins :) .
Bran means Raven in Celtic languages. Or maybe is a coincidence, who knows .
Did you also made an autosomal DNA and if you made, can you share your results or just Y DNA and MT-DNA?
 
Yes, they have it available in their catalog. But sometimes not every known SNP/subclade is included in a Panel. By inquiring, I meant in case they don't automatically test you for it, I would ask them if they will test it as part of the J2b-M12 Panel that you ordered, so you don't have to order it separately for an additional $18. I would also send them this tree from the J2 Project where it shows it downstream J-PH1602>PH1568: http://tree.j2-m172.info/?Hg=J2b2a1a1b1b1

I've asked them and they will test it as a part of J2b-M12 Panel. As soon as I get the final results I will update everything here.
 
Last edited:
<...> Did you also made an autosomal DNA and if you made, can you share your results or just Y DNA and MT-DNA?

Y-DNA and mtDNA with 23andMe which revealed J-L283 and then I ordered YSEQ J2b-M12 Panel as Trojet recommended.
 
Back
Top