Recent content by telsh

Very interesting story, really. I come from Romania and my final subclade is PH3514 - according to YSEQ. This is a subclade of PH1602, as it can be seen here. It appears to have spread from the Balkans and it's probably related to a kind of mix Illyrians - Thracians - Vlachs. Science will...

I have an important update for this thread: YSEQ informed me that my final haplogroup is PH3514. Any ideas how I can contribute with my result to the existent information? I mean where and how can I upload my YSEQ J2b-M12 Panel results so they can be visible on Yfull, FTDNA or other site(s) of...

Only the 23andMe’s autosomal bundle test which is reflected in their Ancestry Service. So if this is what you’re after, then here's my ancestry composition:

Y-DNA and mtDNA with 23andMe which revealed J-L283 and then I ordered YSEQ J2b-M12 Panel as Trojet recommended.

I've asked them and they will test it as a part of J2b-M12 Panel. As soon as I get the final results I will update everything here.

Here's what I found on their website: PH3514 hg38 Position: ChrY:15809390..15809390 Ancestral: G Derived: A Reference: Pille Hallast et al. (2014) ISOGG Haplogroup: J2 (not listed) Comments: Downstream PH1601 Forward Primer: PH3514_F AAGAAACCCTGGTTGGAAGC Reverse Primer: PH3514_R...

Interesting scenario. I'm not sure about that, maybe you go a bit too far in the past. Here's what I've personally found about that word: "The patronym Moroianu derives from a nickname by which the inhabitants of the hill areas of Muntenia called the Romanian migrant shepherds from Bran...

Thanks a lot Trojet for your explanations. From my understanding CTS3617 (which is currently still processing) comes before PH1568 (J-Y40288) so it should be also positive. In this case the only subclade below PH1568 seems PH3514. Is this the only one I should be testing at this point or...

I am in the process of being tested for YSEQ J2b-M12 and I've received a part of my results today. However I really need help interpreting what it all means. My allele results are as follows: M241 A+ PH1568 C+ Z638 G- Z2432 G- CTS3617 processing Z590 processing I think the minus sign means...

I'm also very curious about what the next test will reveal. While as far as I know my grandfather who was born in Moroeni had no relatives of other ethnicity up until his own grandparents (at least not that he would be aware of), according to my 23andMe ancestry composition, Argeș county pops...

My MtDNA haplogroup has been classified as J1 but my brother got J1c. And we have the same mother. It's a bit funny because his Y-DNA haplogroup according to 23andMe was "only" J-M241, whereas mine is J-L283.

Hi Dreptul Valah, Actually it's Moroeni, not Moroieni. Dâmboviţa county.

Hi Trojet, Thanks a lot for your input. I have decided to go for the YSEQ J2b-M12 test. I will update here whatever I get. I'm really curious :) Thanks all for your support.

Hi guys, First of all I would like to thank you for all the information and recommendations provided. I really appreciate this. I am definitely going to go deeper into my haplogroup's subcladic investigation, but I still have to decide which way to go first. At this point I have decided...

Hi Stuvanè and thanks a lot for your reply. I have managed to upload my genome on gedmatch and familytreedna.com but further than that I don't know what to do next. I believe I should purchase additional test products according to my Y-DNA? Do you have any other suggestions - other resources I...